《【病毒外文文獻(xiàn)】2003 Reverse genetics with a full-length infectious cDNA of severe acute respiratory syndrome coronavirus》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2003 Reverse genetics with a full-length infectious cDNA of severe acute respiratory syndrome coronavirus（6頁珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

Reverse genetics with a full length infectious cDNA of severe acute respiratory syndrome coronavirus Boyd Yount Kristopher M Curtis Elizabeth A Fritz Lisa E Hensley Peter B Jahrling Erik Prentice Mark R Denison Thomas W Geisbert and Ralph S Baric H20648 Departments of Epidemiology and Microbiology and Immunology and Carolina Vaccine Institute University of North Carolina Chapel Hill NC 27599 7435 U S Army Medical Research Institute of Infectious Diseases Fort Detrick MD 21702 and Departments of Pediatrics and Microbiology and Immunology Elizabeth B Lamb Center for Pediatric Research Vanderbilt University Medical Center Nashville TN 37232 Communicated by Peter Palese Mount Sinai School of Medicine New York NY August 29 2003 received for review August 7 2003 A previously undescribed coronavirus CoV is the etiologic agent responsible for severe acute respiratory syndrome SARS Using a panel of contiguous cDNAs that span the entire genome we have assembled a full length cDNA of the SARS CoV Urbani strain and have rescued molecularly cloned SARS viruses infectious clone SARS CoV that contained the expected marker mutations inserted into the component clones Recombinant viruses replicated as efficiently as WT virus and both were inhibited by treatment with the cysteine proteinase inhibitor 2S 3S transepoxysuccinyl L leucylamido 3 methylbutane ethyl ester In addition subgenomic transcripts were initiated from the consensus sequence ACGAAC in both the WT and infectious clone SARS CoV Availability of a SARS CoV full length cDNA provides a template for manipulation of the viral genome allowing for the rapid and rational develop ment and testing of candidate vaccines and therapeutics against this important human pathogen S evere acute respiratory syndrome SARS is a life threatening respiratory disease that probably originated in Guangdong Province China in the fall of 2002 1 2 A previously undescribed coronavirus CoV isolated from febrile and dying patients is the etiologic agent responsible for the disease 3 8 SARS CoV infection is associated with overall case fatality rates thought to approach H1101514 15 with selected populations being at increased risk www who intH20862csrH20862sarsH20862 archiveH208622003H1406105H1406107aH20862en SARS CoV infected H110228 000 individ uals and caused H11022800 deaths www who intH20862csrH20862sarsH20862en before aggressive infection control measures successfully contained the scope of the outbreak Despite intensive efforts no effective antiviral treatments against SARS have been described CoVs members of the order Nidovirus contain the largest single stranded positive polarity RNA genome in nature and are divided into three main serogroups group I CoVs trans missible gastroenteritis virus TGEV and human CoV 229E HCV 229E group II mouse hepatitis virus MHV and bovine CoV and group III infectious bronchitis virus IBV Although initial phylogenetic comparisons suggested that SARS CoV may represent the prototype strain of group IV 6 8 10 more recent analyses characterized SARS CoV as an early split off among group II 11 The SARS CoV genomic RNA is H1101529 700 bp in length and has several large ORFs encoded in subgenomic and full length mRNAs 8 10 The subgenomic mRNAs comprise a nested set of 3H11032 coterminal molecules in which the leader RNA sequences encoded at the 5H11032 end of the genome are joined to body sequences at distinct transcription regulatory sequences containing a highly conserved consensus sequence CS The exact SARS CS has been predicted as either CUAAAC or AAACGAAC 8 9 The SARS CoV genome length RNA is likely encapsidated by multiple 50 kDa nucleocapsid proteins N 8 As with other CoVs the virion contains several viral structural proteins including the spike glycoprotein of H11015140 kDa S a 23 kDa membrane glycoprotein M and an H1101510 kDa E protein The CoV gene 1 or replicase gene comprises two thirds of the genome MHV and SARS CoV contain two overlapping ORFs ORF1a and ORF1b which are connected by a ribosomal frame shift Fig 1A In MHV three proteinases papain like protein ases 1 and 2 11 14 and 3C like proteinase mediate cleavage of the polyproteins into at least 15 mature proteins 11 15 The SARS virus replicase gene is predicted to encode only the papain like proteinase 2 and 3C like proteinases 6 7 Continuous polyprotein processing is crucial for ongoing virus transcription therefore MHV replication is sensitive to protease inhibitors that prevent replicase processing 12 Additional functions have been predicted for proteins processed from the replicase polyprotein including an RNA dependent RNA poly merase pol an RNA helicase hel a capping enzymatic activity and several putative RNA processing enzymatic activ ities 6 11 16 In this article we recover recombinant SARS CoV from a full length cDNA of the genome by using an approach that will allow for rapid genetic analysis of SARS CoV protein functions and replication Experimental Procedures Virus and Cells The Urbani and Canadian strains Tor 2 and Tor 7 of SARS CoV were propagated in VeroE6 cells in MEM supplemented with 10 FCS kanamycin 0 25 H9262gH20862ml and gentamyacin 0 05 H9262gH20862ml at 37 C in a CO 2 incubator Cultures of VeroE6 cells were infected at a multiplicity of infection of 0 1 for 30 min washed and titered by plaque assay At 1 h after infection some cultures were treated with the cysteine protease inhibitor 2S 3S transepoxysuccinyl L leucylamido 3 methylbutane ethyl ester E64 d at a concentration of 500 H9262gH20862ml Virus plaques were visualized by neutral red staining at 2 d after infection MHV A59 was grown as described in the presence or absence of E64 d 12 17 Strategy for Cloning the SARS CoV cDNAs Reverse transcription was performed by using SuperScript II oligodeoxynucleotide primers and intracellular RNA from SARS infected cultures 17 18 The cDNA was denatured for 2 min at 94 C and amplified by PCR with Expand Long TAQ polymerase Roche Molecular Biochemicals for 25 cycles at 94 C for 30 sec 58 C for 25 30 sec and 68 C for 1 7 min The amplicons were cloned into Topo II TA Invitrogen SARS subclones D F or in pSMART vectors Lucigen Middleton WI SARS subclones A C All cDNAs were assembled as CSs based on independent sequence analysis of four to seven sibling clones and the reported Abbreviations CoV coronavirus SARS severe acute respiratory syndrome icSARS infec tious clone SARS E64 d 2S 3S transepoxysuccinyl L leucylamido 3 methylbutane ethyl ester TGEV transmissible gastroenteritis virus MHV mouse hepatitis virus IBV infectious bronchitis virus CS consensus sequence B Y and K M C contributed equally to this work H20648 To whom correspondence should be addressed E mail rbaric email unc edu 2003 by The National Academy of Sciences of the USA www pnas orgH20862cgiH20862doiH2086210 1073H20862pnas 1735582100 PNAS H20841 October 28 2003 H20841 vol 100 H20841 no 22 H20841 12995 13000 MICROBIOLOGY Urbani sequence 8 The following primers were used in the isolation of the SARS A subclone forward tactaatacgactcac tatagatattaggtttttacctacccagg 1 reverse acaccatagtcaacgatgcc 4452 SARS B subclone forward gcctatatgcatggatgttagat 4359 reverse tgaaccgccacgctggctaaacc 8727 SARS C subclone for ward agccagcgtggcggttcatac 8710 reverse aggcctcttgggcagtg gcataag 12085 SARS D subclone forward actgcccaagatgcctat gagc 12070 reverse cagccaggagggcagacttcacaacc 18939 SARS E subclone forward gtctgccctcctggctgataagtttccag 18923 reverse gagcagccgtgtaggcagcaat 24066 and SARS F subclone forward attgctgcctacacggctgctc 24045 reverse ttt 7 gtcattctcc taagaagc 29710 To repair sibling clones primer pairs were designed that con tained a class IIS restriction enzyme like AarI By using high fidelity PCR the consensus portions of different sibling clones were amplified digested with AarI and ligated into plasmid The AarI junctions were designed to seamlessly link consensus fragments resulting in the production of a full length cDNA fragment for each of the various SARS cDNA subclones 17 By using an automated Applied Biosystems DNA sequencer two to three candidate DNAs were sequenced to identify the consensus clone Systematic Assembly of a Full Length SARS CoV cDNA The SARS A F inserts were restricted separated through 0 8 agarose gels visualized with a darkreader lightbox Clare Chemical Research Dolores CO excised and purified by using the Qiaex II DNA purification kit The SARS A H11001 B C H11001 D and E H11001 F subclones were ligated overnight and isolated 17 18 The SARS AB H11001 CD H11001 EF cDNAs were ligated overnight at 4 C phenolH20862chloroform extracted and precipitated Transcripts were generated in vitro TmMessage mMachine Ambion as de scribed by the manufacturer with certain modifications 17 For SARS N transcripts 1 H9262g of plasmid DNA encoding the N gene primer 5H11032 nnggcctcgatggccatttaggtgacactatagatgtctgataatgg accccaatc 3H11032 and reverse primer 5H11032 nnnttttttttttttttttttttttttt tatgcctgagttgaatcagcag 3H11032 were transcribed by SP6 RNA poly merase with a 2 1 ratio of cap analog to GTP Transfection of Full Length Transcripts RNA transcripts were added to 800H9262l of the BHK cell suspension 8 0H1100310 6 and three electrical pulses of 850 V at 25 H9262F were given with a Gene Pulser II electroporator Bio Rad 17 18 The BHK cells were seeded with 1 0 2 0 H11003 10 6 VeroE6 cells in a 75 cm 2 flask and incubated at 37 C for 2 d Virus progeny were then purified by plaque assay For fluorescent Ab staining cells were washed in PBS and incubated with goat serum for 20 min at room temperature The cells were washed incubated with a 1 200 dilution of MHV polyclonal antiserum that cross reacts with the SARS N protein and then incubated in Alexa 488 diluted 1 400 for 30 min The cells were fixed in 10 neutral phosphate buffered formalin for 24 h rinsed for 30 min and visualized under a fluorescent microscope Detection of Marker Mutations Inserted in Infectious Clone ic SARS CoV Intracellular RNA was isolated from either WT or icSARS CoV infected cells at 24 h after infection After RT PCR we obtained a 1668 nt amplicon nucleotide positions 1007 2675 spanning the BglI site at position 1557 that had been ablated in the icSARS CoV component clones but not WT SARS CoV Other PCR products included a 799 nt amplicon spanning the mRNAs 8 B Several BglI interconnecting junctions were inserted between the component clones to allow assembly of a full length cDNA Lowercase letters represent WT sequence and numbers represent nucleotide positions in genome C No see m Aar I repair of SARS sibling clones Asterisks represent sites of mutation Numbers in bold represent portions of sibling clones that were assembled into a consensus SARS F subclone Fig 1 Assembly of a full length SARS CoV cDNA A Structure of the SARS CoV genome 8 9 The SARS UrbaniH1101529 727 bp genome contains 10 or more ORFs which are expressed from full length and subgenomic length 12996 H20841 www pnas orgH20862cgiH20862doiH2086210 1073H20862pnas 1735582100 Yount et al SARS CoV BH20862C junction nucleotide positions 8381 9180 a 544 nt amplicon nucleotide positions 11721 12265 spanning the SARS CoV CH20862D junction a 652 nt amplicon spanning the SARS CoV DH20862E junction and a 1594 nt amplicon nucleotide positions 23665 25259 spanning the SARS CoV EH20862F junction The 1594 nt SARS EH20862F junction containing amplicon was sub cloned and sequenced RT PCR of Leader Containing Transcripts Leader containing ampli cons were obtained from WT and icSARS CoV infected cells by using primers at the 3H11032 end of the genome 5H11032 tttttttttttttttttttt tgtcattctcctaagaagc 29710 3H11032 or in the X5 or X3 ORFs 5H11032 ttaattaattaatttgttcgtttatttaaaacaaca 28091H11032 3H11032 5H11032 ttaattaattatggata atctaactccataggttct 27238 3H11032 and in the SARS leader RNA sequence at the 5H11032 end of the genome 5H11032 aaagccaaccaacctcgatc 3H11032 nucleotides 26 35 Leader containing amplicons were sub cloned into TopoII vectors and sequenced Results Assembly of SARS Full Length cDNAs Rapid response and control of exigent emerging pathogens requires an approach to quickly generate full length cDNAs from which molecularly cloned viruses are rescued allowing for genetic manipulation of the genome Full length cDNAs were isolated for TGEV HCoV 229E IBV and MHV A59 by using a variety of approaches 17 21 Our strategy includes a panel of cDNAs spanning the entire CoV genome which can be systematically and direction ally assembled into a genome length cDNA by in vitro ligation 17 18 The SARS genome was cloned as six contiguous subclones that could be systematically linked by unique BglI restriction endonuclease sites Fig 1 BglI is a class IIS restric tion endonuclease that cleaves the symmetrical sequence GCCNNNN 2 NGGC but leaves 64 different asymmetrical ends Consequently pairs of contiguous subclones encoded junctions that allow unidirectional assembly of intermediates into a full length cDNA As shown in Fig 1A twoBglI junctions were derived from sites encoded within the SARS CoV genome at nucleotide positions 4373 AH20862B junction and 12065 CH20862D junction 8 10 A third BglI site at nucleotide position 1577 was removed and new BglI sites were inserted by the introduction of silent mutations into the SARS CoV sequence at nucleotide 8700 BH20862C junction nucleotide 18916 DH20862E junction and at nucleotide 24040 EH20862F junction Fig 1B As described with MHV and TGEV SARS CoV sequence toxicity was circum vented by disruption of toxic domains and the use of stable cloning vectors 17 The resulting cDNAs include SARS A nucleotides 1 4436 SARS B nucleotides 4344 8712 SARS C nucleotides 8695 12070 SARS D nucleotides 12055 18924 SARS E nucleotides 18907 24051 and SARS F nu cleotides 24030 29736 subclones The SARS A subclone con tains a T7 promoter and the SARS F subclone terminates in 21Ts allowing for in vitro transcription of capped polyadenyl ated transcripts Numerous mutations were noted in each of the four to seven sibling subclones encoding a given SARS cDNA fragment Fig 1C To rapidly assemble consensus clones we used class IIS restriction endonucleases that cut at asymmetric sites and leave asymmetric ends These enzymes generate strand specific unique overhangs that allow the seamless ligation of two cDNAs with the concomitant loss of the restriction site 17 As illus trated with the SARS F sibling subclones primers were designed that contained terminal Aar I CACCTGCNNNN 2 NNNN sites that flanked each of the various consensus portions of different sibling clones In some instances amplicons 3 and 2 in sibling clones 1 and 4 respectively the primers repaired specific mutations located near the ends of a given amplicon Fig 1C The combination of high fidelity PCR oligonucleotide primer repair and the seamless ligation of sequence fragments 17 rapidly generated Urbani consensus cDNAs for each of the SARS A B C D E and F subclones Fig 1C Silent changes retained in the full length construct included an A to G change at nucleotide position 6460 aTtoCatnucleotide position 14178 a T to C at nucleotide position 15740 aCtoTatnucleotide position 19814 an A to G at nucleotide position 20528 and a T to C at nucleotide position 20555 Rescue of Molecularly Cloned SARS CoV To build a full length SARS CoV cDNA subclones were digested with the appropri ate restriction enzymes ligated together and used as template for in vitro transcription with the T7 RNA polymerase Because N transcripts enhance infectivity of TGEV and MHV transcripts 17 22 and are essential for IBV transcript infectivity 20 SARS CoV full length transcripts were tested alone or mixed with SARS CoV N transcripts and electroporated into cells Within 48 h SARS CoV infected cells were detected by fluo rescent Ab staining Fig 2 A C Rescued recombinant virus icSARS CoV titers approached 1 0 H11003 10 6 plaque forming unitsH20862ml at 48 h after infection in the mixed transcript trans Fig 2 SARS CoV full length transcripts are infectious Full length tran scripts in the presence or absence of SARS N transcripts were electroporated into BHK cells and overlaid with susceptible VeroE6 cells A portion of the cells was examined by fluorescent Ab staining A Cultures transfected with SARS CoV full length transcripts B SARS full length transcripts plus N transcripts C Uninfected control D Virus growth was determined for the first 96 h after transfection by plaque assay icSARS transcripts alone a73 and icSARS plus N transcripts trials 1 and2 E icSARS CoV and WT SARS CoV plaques in Vero E6 cells Yount et al PNAS H20841 October 28 2003 H20841 vol 100 H20841 no 22 H20841 12997 MICROBIOLOGY fected cultures Fig 2D Recombinant viruses were also de tected in cultures transfected with genome length SARS CoV transcripts alone but titers were reduced SARS CoV N tran scripts may enhance but are not essential for infectivity of SARS full length transcripts Molecular cloned viruses produced sim ilar sized plaques as WT SARS CoV Urbani Fig 2E icSARS CoV Marker Mutations Rescued icSARS CoV but not WT SARS CoV should contain several BglI sites that were engi neered as junctions between the SARS BH20862C DH20862E and EH20862F subclones and lack the BglI site at nucleotide position 1577 Intracellular RNA was isolated from infected cultures RT PCR amplified by using primer pairs flanking these various sites and subjected to restriction fragment length polymorphism analysis with BglI Clearly icSARS CoV contained the marker mutations inserted within and between the component clones Fig 3 A and B Selected amplicons were cloned and sequenced demonstrat ing that the icSARS CoV originated from transcripts derived from the full length cDNA construct Fig 3C Phenotype of Rescued icSARS CoV Recombinant icSARS CoV replicated as efficiently as WT Urbani but slightly less efficiently than the Tor 2 and Tor 7 SARS CoV isolates Fig 4A All viruses replicated to titers of H110151 5 H11003 10 7 within H1101524 48 h after infection icSARS CoV subgenomic mRNAs should contain a common H1101572 nt leader RNA sequence which is derived from the 5H11032 end of the genome Intracellular RNA was isolated from Urbani WT and icSARS CoV infected cultures Primer pairs were derived from the leader RNA sequence and from various locations at the 3H11032 end of the genome After RT PCR amplifi cation of leader containing amplicons sequence analysis indi cated that eight WT and icSARS CoV subgenomic transcripts originated at identical CS sites defined by the core sequence ACGAAC Fig 4B This sequence represents a truncation of the AAACGAAC CS site that had been predicted by Rota et al 8 and is different from the group I II and III CoV CS CUAAAC TGEV UCTAAAC MHV and CUUAACAA IBV respectively Although some previous studies suggested that the SARS E protein and ORF X3 might be expressed from multicistronic mRNA our findings indicate that independent transcripts are initiated at the core CS ACGAAC noted at nucleotide positions 26109 for E transcripts and 26913 for ORF X3 transcripts respectively Fig 4B Several may encode two or more ORFs Fig 4B 11 Using 5H11032 RACE SARS N transcripts contained an identical 72 nt 5H11032 leader RNA sequence derived from the 5H11032 end of the genome data not shown In Vitro Inhibition of SARS CoV Replication During MHV and foot and mouth disease virus infection the cysteine proteinase inhibitor E64 d blocks replicase polyprotein processing thereby inhibiting viral RNA synthesis and growth 12 E64 d is non cytotoxic to cells and does not inhibit cellular RNA synthesis Moreover removal of the E64 d allows recovery of virus repli cation 12 To determine whether icSARS CoV was susceptible to the inhibitory effects of E64 d growth comparisons were performed in the presence and absence of drug In the absence of E64 d WT and icSARS CoV grew to equivalent titers of H110151 0 H11003 10 7 plaque forming unitsH20862ml after 24 48 h after infec tion Untreated infected VeroE6 cells showed extensive cyto pathi