《【病毒外文文獻】2011 Virally Expressed Interleukin-10 Ameliorates Acute Encephalomyelitis and Chronic Demyelination in Coronavirus-Infec》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻】2011 Virally Expressed Interleukin-10 Ameliorates Acute Encephalomyelitis and Chronic Demyelination in Coronavirus-Infec（10頁珍藏版）》請在裝配圖網(wǎng)上搜索。

JOURNAL OF VIROLOGY July 2011 p 6822 6831 Vol 85 No 14 0022 538X 11 12 00 doi 10 1128 JVI 00510 11 Copyright 2011 American Society for Microbiology All Rights Reserved Virally Expressed Interleukin 10 Ameliorates Acute Encephalomyelitis and Chronic Demyelination in Coronavirus Infected Mice H17188 Kathryn Trandem 1 Qiushuang Jin 2 Kayla A Weiss 1 Britnie R James 1 Jingxian Zhao 2 3 and Stanley Perlman 2 Interdisciplinary Program in Immunology 1 and Department of Microbiology 2 University of Iowa Iowa City Iowa 52242 and Institute for Tissue Transplantation and Immunology Jinan University Guangzhou 510630 China 3 Received 14 March 2011 Accepted 9 May 2011 The absence of interleukin 10 IL 10 a potent anti inflammatory cytokine results in increased immune mediated demyelination in mice infected with a neurotropic coronavirus recombinant J2 2 V 1 rJ2 2 Here we examined the therapeutic effects of increased levels of IL 10 at early times after infection by engineering a recombinant J2 2 virus to produce IL 10 We demonstrate that viral expression of IL 10 which occurs during the peak of virus replication and at the site of disease enhanced survival and diminished morbidity in rJ2 2 infected wild type B6 and IL 10 H11546 H11546 mice The protective effects of increased IL 10 levels were associated with reductions in microglial activation inflammatory cell infiltration into the brain and proinflammatory cytokine and chemokine production Additionally IL 10 increased both the frequency and number of Foxp3 H11545 regulatory CD4 T cells in the infected central nervous system Most strikingly the ameliorating effects of IL 10 produced during the first 5 days after infection were long acting resulting in decreased demyelination during the resolution phase of the infection Collectively these results suggest that the pathogenic processes that result in demyelination are initiated early during infection and that they can be diminished by exogenous IL 10 delivered soon after disease onset IL 10 functions by dampening the innate or very early T cell immune response Further they suggest that early treatment with IL 10 may be useful adjunct therapy in some types of viral encephalitis The anti inflammatory cytokine interleukin 10 IL 10 is a pleiotropic cytokine that is produced in abundant quantities dur ing most parasitic bacterial viral and fungal diseases Until re cently IL 10 was believed to be most important during chronic infections with its expression linked to the development of chronic infections in mice such as those caused by Leishmania major lymphocytic choriomeningitis virus LCMV and Toxo plasma gondii 3 5 12 44 In these infections abrogation of IL 10 mediated immunosuppression results in accelerated patho gen clearance and this is sometimes accompanied by immuno pathological disease IL 10 has also been implicated in pathogen persistence in chronic human infections such as hepatitis C virus HCV and Mycobacterium tuberculosis 10 16 Only recently has a role for IL 10 in acute diseases been appreciated In acute viral infections caused by pathogens such as influenza A virus IAV simian virus 5 SV5 respiratory syncytial virus RSV and mouse hepatitis virus MHV IL 10 production is maximal at the height of the adaptive inflamma tory response with IL 10 expressed largely by virus specific CD4 and CD8 T cells 27 30 36 37 39 41 We and others showed that virus specific IL 10 H11001 CD8 T cells are more acti vated and cytolytic than are IL 10 H11002 CD8 T cells responding to the same epitope 39 41 IL 10 primarily acts to suppress macrophages and dendritic cell DC function by inhibiting expression of major histocompatibility complex MHC class II and costimulatory molecules such as CD80 CD86 and produc tion of proinflammatory cytokines and chemokines including IL 12 31 IL 10 also has direct effects on T cells inhibiting activation and cytokine expression Production of IL 10 by highly activated virus specific T cells raises the possibility that IL 10 functions via both autocrine and paracrine signaling to limit inflammation during acute phases of the disease Never theless the importance of IL 10 s anti inflammatory effects in acute disease is not firmly established since it continues to be expressed during the resolution phases of an infection IL 10 diminished disease in mice infected with a variant of MHV strain JHMV J2 2 V 1 that causes mild acute enceph alitis and chronic demyelinating encephalomyelitis 4 38 De myelination in these mice is largely mediated by the immune response 43 45 Infection of IL 10 H11002 H11002 mice resulted in in creased morbidity and mortality and augmented demyelination compared to wild type mice 43 45 To determine IL 10 s role during the early stages of infection we engineered recombi nant J2 2 V 1 rJ2 2 expressing IL 10 rJ2 2 IL 10 or encod ing a nonfunctional version of the gene rJ2 2 H9004IL 10 Infec tion with rJ2 2 IL 10 resulted in expression of high levels of IL 10 at the site of infection with levels that became undetect able as the virus was cleared Since IL 10 has a half life of approximately 2 h 26 cytokine levels track with virus clear ance making this a useful system for evaluating the role of exogenously added IL 10 during the peak phase of the infec tion We show that early viral expression of IL 10 enhanced survival and diminished chronic demyelination in rJ2 2 in fected B6 and IL 10 H11002 H11002 mice MATERIALS AND METHODS Mice Specific pathogen free 6 week old C57BL 6 B6 mice were purchased from the National Cancer Institute Bethesda MD IL 10 H11002 H11002 B6 129P2 Il10tm1Cgn J mice were bred in the animal facility of the University of Iowa After viral inoculation mice were examined and weighed daily Clinical evalua Corresponding author Mailing address Department of Microbiol ogy BSB 3 730 University of Iowa Iowa City IA 52242 Phone 319 335 8549 Fax 319 335 9999 E mail Stanley Perlman uiowa edu H17188 Published ahead of print on 18 May 2011 6822 on March 11 2015 by guest http jvi asm org Downloaded from tion was based on the following scoring system 0 asymptomatic 1 limp tail 2 wobbly gait with righting difficulty 3 hind limb weakness and extreme righting difficulty 4 hind limb paralysis 5 moribund All animal studies were approved by the University of Iowa Animal Care and Use Committee Recombinant viruses Targeted recombination was used to generate recom binant virus as previously described 21 29 We introduced the Il10 gene produced synthetically GENEART Burlingame CA into rJ2 2 replacing part of open reading frame 4 ORF4 as described previously Fig 1A 17 18 Insertion of exogenous genetic material into ORF4 does not affect virulence 35 For a control another construct was made in which the start codon ATG was mutated to ATC boldface nucleotide changed and Arg AGA and Gln CAG residues at positions 13 and 19 of the Il10 gene were mutated to termination codons TGA and TAG respectively using overlapping extension PCR des ignated pJ2 2 H9004IL 10 Recombinant viruses were propagated and the titers of the viruses were determined on 17Cl 1 and HeLa MHVR cells respectively 17 18 21 35 Sequence analysis prior to use in further studies confirmed the presence of the introduced genes To control for any unwanted mutations that might have occurred during the process of targeted recombination multiple isolates of each virus were developed three rJ2 2 IL 10 isolates and two rJ2 2 H9004IL 10 isolates Identical results were obtained with the different isolates Sub sequently most in vivo experiments used single isolates of rJ2 2 IL 10 and rJ2 2 H9004IL 10 Mice were inoculated intracerebrally i c with 1 000 or 500 PFU in 30 H9262l of Dulbecco modified Eagle medium DMEM To confirm retention of IL 10 or deletion of IL 10 RNA was analyzed by reverse transcription PCR RT PCR using virus specific primers that flanked the inserted sequence as described previously 17 18 A 608 nucleotide product is expected if the insert is present Growth kinetics and expression of IL 10 in tissue culture 17Cl 1 cells were infected with virus at a multiplicity of infection of 1 PFU per cell Samples were harvested at the indicated times Viral titers were determined on HeLa MHVR cells and IL 10 expression was determined by enzyme linked immunosorbent assay ELISA Antibodies and flow cytometric analyses All antibodies were purchased from BD Pharmingen San Diego CA unless indicated otherwise below Natural killer NK cells were CD45 H11001 CD3 H11002 NK1 1 H11001 Macrophages were CD45 H11001 CD11b H11001 Ly6C H11001 Ly6G H11002 Neutrophils were CD45 H11001 CD11b H11001 Ly6C H11001 Ly6G H11001 Microglia were CD45 int CD11b H11001 MHC class II was detected with fluorescein isothiocyanate FITC conjugated anti I A I E antibodies from eBioscience San Diego CA Microglial activation was assessed by measuring the expression of CD40 and CD80 eBioscience and CD86 Biolegend San Diego CA For detection of regulatory T cells Tregs cells were stained with peridinin chloro phyll protein PerCP conjugated anti CD4 monoclonal antibody MAb After permeabilization and fixation cells were stained with phycoerythrin PE conju gated anti Foxp3 antibody or PE conjugated isotype control rat IgG2a MAb as described by the manufacturer eBiosciences For detection of intracellular cytokine expression CD8 or CD4 T cells were stimulated for 5 h with 1 H9262M peptide S510 spanning residues S510 to 518 of the surface S glycoprotein or 5 H9262M peptide M133 spanning residues M133 to 147 of the transmembrane M protein in the presence of 1 H9262l ml Golgiplug BD Pharmingen and antigen presenting cells APCs CHB3 cells H 2D b I A b Intracellular gamma interferon IFN H9253 and IL 10 expression was detected following fixation and permeabilization BD Pharmingen Cells were then incubated with anti CD16 CD32 biotin and anti CD4 or anti CD8 followed by avidin PerCP Results are shown after gating on CD16 CD32 negative cell populations Cells were analyzed using a FACSCalibur BD Biosciences Preparation of central nervous system CNS mononuclear cells Brain mono nuclear cells were isolated as described previously 48 Briefly tissue was dis FIG 1 Generation and expression of recombinant rJ2 2 IL 10 and rJ2 2 H9004IL 10 A Schematic diagram of rJ2 2 IL 10 and rJ2 2 H9004IL 10 showing the insertion of the IL 10 gene into gene 4 of rJ2 2 and a mutated initiation and two introduced stop codons in rJ2 2 H9004IL 10 Abbreviations HE hemagglutinin esterase S surface E envelope M transmembrane N nucleocapsid B 17Cl 1 cells were infected with wild type WT rJ2 2 rJ2 2 IL 10 or rJ2 2 H9004IL 10 and 24 h later supernatants were collected for measurement of IL 10 by ELISA C 17Cl 1 cells were infected with rJ2 2 rJ2 2 IL 10 or rJ2 2 H9004IL 10 and harvested at various time points for viral titers Data are from two independent experiments with 2 or 3 replicates experiment VOL 85 2011 IL 10 AMELIORATES VIRAL ENCEPHALOMYELITIS 6823 on March 11 2015 by guest http jvi asm org Downloaded from persed using 25 gauge needles and digested with collagenase D 1 mg ml Roche Diagnostics and DNase I 0 1 mg ml Roche Diagnostics at 37 C for 30 min Mononuclear cells were isolated by passing the tissue through a 70 H9262m cell strainer and centrifugation after resuspension in 30 Percoll Pharmacia Upp sala Sweden ELISA Brain tissue samples were homogenized directly into 50 mM Tris 150 mM NaCl 5 mM EDTA 1 mM Na 3 VO 4 1 NP 40 and a protease inhibitor cocktail Complete protease inhibitor cocktail Roche Mannheim Germany as described previously 40 IL 10 IL 6 tumor necrosis factor TNF and chemo kine C C motif ligand 2 CCL2 ELISAs were performed using reagents and protocols provided by the manufacturer eBioscience Samples were plated in duplicate Quantification of demyelination For examination of demyelination 8 H9262m zinc formalin fixed sections were stained with luxol fast blue LFB and counterstained with hematoxylin and eosin Images of stained spinal cord sections were digitalized using an Optiphot charge coupled camera attached to a Leitz diaplan light microscope Leica Microsystems Wetzlar Germany Quantification of demyelination was performed in a blind manner as previ ously described 46 qRT PCR Brain RNA was extracted using TRIzol reagent Invitrogen Life Technologies Carlsbad CA and reverse transcribed using Superscript II In vitrogen according to the manufacturer s instructions Cytokine mRNA levels were quantified by quantitative reverse transcription PCR qRT PCR using SYBR green SA Biosciences Frederick MD The primers used for qRT PCR were as follows IL 10 F F for forward 5H11032 GCGTCGTGATTAGCGATGAT G 3H11032 IL 10 R R for reverse 5H11032 CTCGAGCAAGTCTTTCAGTCC 3H11032 TNF F 5H11032 TCAGCCGATTTGCTATCTCA 3H11032 TNF R 5H11032 CGGACTCCGCAAAGTC TAAG 3H11032 CCL2 F 5H11032 AGCACCAGCCAACTCTCACT 3H11032 CCL2 R 5H11032 TCAT TGGGATCATCTTGCTG 3H11032 IL 6 F 5H11032 ACCACGGCCTTCCCTACTTC 3H11032 IL 6 R 5H11032 CTCATTTCCACGATTTCCCAG 3H11032 chemokine C X C motif li gand 10 CXCL10 F 5H11032 AAGTGCTGCCGTCATTTTCT 3H11032 CXCL10 R 5H11032 T TCATCGTGGCAATGATCTC 3H11032 hypoxanthine guanine phosphoribosyltrans ferase HPRT F 5H11032 GCGTCGTGATTAGCGATCATC 3H11032 HPRT R 5H11032 CTC GAGCAAGTCTTTCAGTCC 3H11032 Amplification was performed using the Applied Biosystems 7300 sequence detector Applied Biosystems Foster City CA The specificity of amplification was confirmed using melting curve analysis Data were analyzed as previously described 20 with normalization to HPRT Statistical analysis Two tailed unpaired Student s t tests were used to analyze differences in mean values between groups A log rank sum test was used to analyze survival curves All results are expressed as means H11006 standard errors of the means SEM Differences with P values of H110210 05 were considered signifi cant RESULTS Generation and expression of IL 10 producing rJ2 2 virus To test the effects of increasing IL 10 levels at early times postinfection p i and at the site of infection we used reverse genetics to develop a rJ2 2 that expressed murine IL 10 rJ2 2 IL 10 Fig 1A For a control we also engineered a virus encoding an IL 10 gene with a mutated start codon and two early stop codons rJ2 2 H9004IL 10 Fig 1A To confirm IL 10 expression we infected murine fibroblast 17Cl 1 tissue culture cells with rJ2 2 three different isolates of rJ2 2 IL 10 or two isolates of rJ2 2 H9004IL 10 IL 10 mRNA was detected in cells infected with rJ2 2 IL 10 or rJ2 2 H9004IL 10 but not rJ2 2 data not shown Sequence analysis confirmed the presence of the full length IL 10 gene in rJ2 2 IL 10 infected cells and a mu tated IL 10 gene in the cells infected with rJ2 2 H9004IL 10 We then examined infected cell supernatants for IL 10 protein expression by ELISA at 24 h p i As shown in Fig 1B all rJ2 2 IL 10 isolates expressed similarly high levels of IL 10 while the rJ2 2 H9004IL 10 isolates and wild type rJ2 2 produced no IL 10 protein To determine whether insertion of IL 10 or H9004IL 10 affected virus replication we examined the kinetics of virus growth in 17Cl 1 cells rJ2 2 IL 10 rJ2 2 H9004IL 10 and rJ2 2 replicated with similar kinetics demonstrating no effect of IL 10 expression on virus replication Fig 1C Exogenous IL 10 expression in rJ2 2 IL 10 infected B6 mice In order to examine the expression of recombinant IL 10 in vivo B6 mice were infected with 1 000 PFU of either rJ2 2 IL 10 or rJ2 2 H9004IL 10 Levels of infectious virus are maximal at days 3 to 5 p i in rJ2 2 infected B6 mice with clearance oc curring by day 14 p i 4 As seen in Fig 2A robust production of IL 10 protein was detected in the CNS of rJ2 2 IL 10 in fected B6 mice IL 10 levels were 10 fold higher in rJ2 2 IL 10 infected mice than in rJ2 2 H9004IL 10 infected mice at day 2 p i although the levels were very similar by day 7 p i By this time p i infectious virus is largely cleared and most IL 10 is derived from the host with IL 10 levels similar to those re ported previously 15 41 Of note serum IL 10 levels in all mice were below the limit of detection 32 0 pg ml Exogenous genes inserted into recombinant mouse hepatitis virus are sometimes deleted during murine infection 9 17 Therefore we examined the brains of rJ2 2 IL 10 and rJ2 2 H9004IL 10 infected mice at day 7 p i by RT PCR to assess reten tion of the IL 10 or H9004IL 10 gene Only PCR products corre sponding to intact IL 10 genes were detected Fig 2B suggesting that significant deletion had not occurred and that IL 10 expression in vivo was stable for at least 7 days Virus gene encoded IL 10 is protective in rJ2 2 infected B6 mice Next we determined whether IL 10 expressed in rJ2 2 IL 10 infected B6 mice diminished disease As shown in Fig 3A rJ2 2 IL 10 infected B6 mice exhibited a slight increase in FIG 2 Expression of virus gene encoded IL 10 is stable in rJ2 2 IL 10 infected mice A and B C57BL 6 B6 A and B or IL 10 H11002 H11002 B mice were infected with rJ2 2 IL 10 or rJ2 2 H9004IL 10 and sacrificed at various times postinfection IL 10 expression in the brain was confirmed by A ELISA and RT PCR B as described in Materials and Methods The broken line depicts the limit of detection Statistical significance is indicated as follows P H11021 0 05 P H11021 0 01 P H11021 0 001 N S not significant Data are from two independent experiments with H113502 mice group 6824 TRANDEM ET AL J VIROL on March 11 2015 by guest http jvi asm org Downloaded from survival compared to mice infected with rJ2 2 H9004IL 10 though this was not statistically significant In contrast weight loss and clinical scores were significantly reduced in rJ2 2 IL 10 in fected B6 mice Fig 3B and C weight loss days 7 to 8 and 14 to 21 P H11021 0 05 clinical score days 18 to 21 P H11021 0 05 However this decrease in clinical disease in rJ2 2 IL 10 in fected B6 mice was associated with diminished ability to con trol virus replication Virus titers were significantly higher at days 5 and 7 p i in rJ2 2 IL 10 infected B6 mice than in rJ2 2 H9004IL 10 infected B6 mice although differences diminished by day 10 p i Fig 3D Virus was cleared from most mice by day 14 p i Immunopathological disease in rJ2 2 infected mice is mani fested by myelin destruction which is maximal at 2 to 3 weeks after infection and occurs during the process of virus clearance 42 To determine whether increased IL 10 expression by dampening the immune response diminished myelin destruc tion we examined infected spinal cords at day 21 p i The level of demyelination in rJ2 2 IL 10 infected mice was significantly decreased compared to those that were infected with rJ2 2 H9004IL 10 Fig 3E to G Inflammatory cell infiltration into the CNS is diminished while Treg frequency and numbers are increased in B6 mice infected with rJ2 2 IL 10 To explore the basis of diminished clinical disease and demyelination in rJ2 2 IL 10 mice we ini tially compared the composition of the cellular infiltrates pres ent in rJ2 2 IL 10 and rJ2 2 H9004IL 10 infected B6 mice Fig 4 At days 3 and 5 p i there was a significantly decreased number of macrophages and polymorphonuclear leukocytes PMNs in the CNS of B6 mice infected with rJ2 2 IL 10 compared to mice infected with rJ2 2 H9004IL 10 Fig 4B and C The total numbers of CD4 and CD8 T cells were decreased at days 5 and 7 when mice infected with rJ2 2 IL 10 and rJ2 2 H9004IL 10 were compared though only the difference in CD4 T cell numbers achieved statistical significance at day 5 p i Fig 4D and E To assess the effects of IL 10 expression on the numbers of virus specific CD4 and CD8 T cells we used intracellular cy tokine staining for IFN H9253 after stimulation with peptides cor responding to immunodominant CD4 M133 and CD8 S510 T cell epitopes Lower numbers but not frequencies of M133 specific CD4 and S510 specific CD8 T cells were detected at day 7 after infection with rJ2 2 IL 10 compared to rJ2 2 H9004IL 10 Fig 4F and G reflecting differences in the total numbers of infiltrating inflammatory cells IL 10 has a role in maintaining Treg